adam10b

Ensembl ID:
ENSDARG00000015502
ZFIN ID:
ZDB-GENE-071115-1
Description:
a disintegrin and metalloprotease domain 10b [Source:RefSeq peptide;Acc:NP_956714]
Human Orthologue:
ADAM10
Human Description:
ADAM metallopeptidase domain 10 [Source:HGNC Symbol;Acc:188]
Mouse Orthologue:
Adam10
Mouse Description:
a disintegrin and metallopeptidase domain 10 Gene [Source:MGI Symbol;Acc:MGI:109548]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24577 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24577
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008663 Essential Splice Site 26 606 1 15
Genomic Location:
Chromosome 25 (position 18357)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGCTCCCGGTGCTGCTGGGCCTCCTCTGCGCCTCCGGGCCCGCTCGAG[G/A]TGAGTGTGAGCCGGTGTGGAGCCGAGCTAACGGTAACGCTAGCTCTCGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fxoeo9cc