Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
iqch
- Ensembl ID:
- ENSDARG00000015476
- ZFIN ID:
- ZDB-GENE-050419-242
- Description:
- IQ motif-containing protein H [Source:UniProtKB/Swiss-Prot;Acc:Q1LXZ7]
- Human Orthologue:
- IQCH
- Human Description:
- IQ motif containing H [Source:HGNC Symbol;Acc:25721]
- Mouse Orthologue:
- Iqch
- Mouse Description:
- IQ motif containing H Gene [Source:MGI Symbol;Acc:MGI:1925500]
Alleles
There are 2 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa36633 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa29020 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa36633
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000079691 | Nonsense | 97 | 1079 | 4 | 21 |
| ENSDART00000135049 | Nonsense | 97 | 1059 | 4 | 21 |
| ENSDART00000147470 | None | 180 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 18 (position 19602831)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 19833054 GRCz11 18 19822120 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AATCAATTGAGATCCAACATATCTAGCCTTTTTTGTAGGCAACCACCATA[C/A]GAAGCATTACCAATTGCACATCCACATAGAAGCCCGATTCCAGGTCCATC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa29020
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000079691 | Essential Splice Site | 578 | 1079 | 13 | 21 |
| ENSDART00000135049 | Essential Splice Site | 578 | 1059 | 13 | 21 |
| ENSDART00000147470 | None | 180 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 18 (position 19622842)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 19853065 GRCz11 18 19842131 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCCCTTTTAGTGTCCCTTTATCTCCTAATGGTGCATTATATTTCTCTTTC[A/T]GACCCGAAACTTATGTCTAGCTTCGCTCCTGAAATACAGTCCACGAACTC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Menarche (age at onset): Thirty new loci for age at menarche identified by a meta-analysis of genome-wide association studies. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
