iqch

Ensembl ID:
ENSDARG00000015476
ZFIN ID:
ZDB-GENE-050419-242
Description:
IQ motif-containing protein H [Source:UniProtKB/Swiss-Prot;Acc:Q1LXZ7]
Human Orthologue:
IQCH
Human Description:
IQ motif containing H [Source:HGNC Symbol;Acc:25721]
Mouse Orthologue:
Iqch
Mouse Description:
IQ motif containing H Gene [Source:MGI Symbol;Acc:MGI:1925500]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36633 Nonsense Mutation detected in F1 DNA During 2017
sa29020 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36633
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079691 Nonsense 97 1079 4 21
ENSDART00000135049 Nonsense 97 1059 4 21
ENSDART00000147470   None 180 None 3
Genomic Location (Zv9):
Chromosome 18 (position 19602831)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19833054
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCAATTGAGATCCAACATATCTAGCCTTTTTTGTAGGCAACCACCATA[C/A]GAAGCATTACCAATTGCACATCCACATAGAAGCCCGATTCCAGGTCCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29020
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079691 Essential Splice Site 578 1079 13 21
ENSDART00000135049 Essential Splice Site 578 1059 13 21
ENSDART00000147470   None 180 None 3
Genomic Location (Zv9):
Chromosome 18 (position 19622842)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19853065
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCTTTTAGTGTCCCTTTATCTCCTAATGGTGCATTATATTTCTCTTTC[A/T]GACCCGAAACTTATGTCTAGCTTCGCTCCTGAAATACAGTCCACGAACTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link