ppp2r5ea

Ensembl ID:
ENSDARG00000015474
ZFIN ID:
ZDB-GENE-030904-7
Description:
protein phosphatase 2, regulatory subunit B', epsilon isoform a [Source:RefSeq peptide;Acc:NP_91939
Human Orthologue:
PPP2R5E
Human Description:
protein phosphatase 2, regulatory subunit B', epsilon isoform [Source:HGNC Symbol;Acc:9313]
Mouse Orthologue:
Ppp2r5e
Mouse Description:
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23672 Nonsense Available for shipment Available now
sa37005 Nonsense Available for shipment Available now
sa31043 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43413 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23672
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009356 Nonsense 37 468 2 14
Genomic Location (Zv9):
Chromosome 20 (position 20320456)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 20348623
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCTGTCAGGAAAGCCCGGCAGAAGCGAGCGCAGAGCTCATCCCAGTTC[A/T]GATCTCAGGACAAGCCCATAGAGCTGGTGGCGCTGCCTCTGCTGAAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37005
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009356 Nonsense 155 468 5 14
Genomic Location (Zv9):
Chromosome 20 (position 20315171)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 20343338
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTCTGATCTTTCTCTCTCTCTCTTTCTTTTCTTTTTAAGCTTGTTTA[T/A]GAGTTCTTCATCCGTTTCTTGGAAAGTCAGGAATTTCAGCCCAGCGCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31043
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009356 Essential Splice Site 318 468 10 14
ENSDART00000009356 Essential Splice Site 318 468 10 14
Genomic Location (Zv9):
Chromosome 20 (position 20312408)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 20340575
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATCAGAGGTTTGTTGAAGTTTTGGCCAAAAACATGCAGTCAAAAGGAG[G/A]TAAGTGTTCTCATTCAGTTATTAAAGTGGTCCCATAATACTTTTAGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43413
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009356 Essential Splice Site 318 468 10 14
ENSDART00000009356 Essential Splice Site 318 468 10 14
Genomic Location (Zv9):
Chromosome 20 (position 20312408)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 20340575
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATCAGAGGTTTGTTGAAGTTTTGGCCAAAAACATGCAGTCAAAAGGAG[G/A]TAAGTGTTCTCATTCAGTTATTAAAGTGGTCCCATAATACTTTTAGTATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link