gpc4

Ensembl ID:
ENSDARG00000015472
ZFIN ID:
ZDB-GENE-011119-1
Description:
glypican-4 [Source:RefSeq peptide;Acc:NP_571935]
Human Orthologue:
GPC4
Human Description:
glypican 4 [Source:HGNC Symbol;Acc:4452]
Mouse Orthologue:
Gpc4
Mouse Description:
glypican 4 Gene [Source:MGI Symbol;Acc:MGI:104902]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22505 Nonsense Mutation detected in F1 DNA During 2014
sa9771 Nonsense Available for shipment Available now
sa11933 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22505
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026569 Nonsense 18 557 1 9
Genomic Location:
Chromosome 14 (position 32020886)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGATGATCGTTGTGTTTACAGTATGTATGTCTGTGGTGGTTTTGGCGT[C/A]GGCTCAGGCTGATCAGAAGTCAAAGAACTGCAATGAAGTCAGAACTGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9771
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026569 Nonsense 28 557 1 9
Genomic Location:
Chromosome 14 (position 32020855)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGTGGTGGTTTTGGCGTCGGCTCAGGCTGATCAGAAGTCAAAGAACTG[C/A]AATGAAGTCAGAACTGCCTACAGTTCCAAAGGTTTCAACGTCAACGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11933
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026569 Nonsense 335 557 5 9
Genomic Location:
Chromosome 14 (position 31965834)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATTTCAGATGCTATCATGAACATGCAGGAGAACAGCATGCAGGTCTCA[C/T]AGAAGGTGGGCTTTTAGTATTTTTYCCATGATGACATGGGAAATCATTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/35zqripb