chd1l

Ensembl ID:
ENSDARG00000015471
ZFIN ID:
ZDB-GENE-040426-892
Description:
Chromodomain-helicase-DNA-binding protein 1-like [Source:UniProtKB/Swiss-Prot;Acc:Q7ZU90]
Human Orthologue:
CHD1L
Human Description:
chromodomain helicase DNA binding protein 1-like [Source:HGNC Symbol;Acc:1916]
Mouse Orthologue:
Chd1l
Mouse Description:
chromodomain helicase DNA binding protein 1-like Gene [Source:MGI Symbol;Acc:MGI:1915308]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14029 Nonsense Available for shipment Available now
sa18631 Nonsense Available for shipment Available now
sa8828 Nonsense Available for shipment Available now
sa9462 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14029
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020505 Nonsense 6 1026 1 25
Genomic Location:
Chromosome 6 (position 36792789)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCAGATGATTTAACATAAACGTAAACAACAAGGATGTCCACATTTCTT[C/T]GAGCAGTCAGAARCAACATACCAGAAAAGGACAAATCTGAACTAACGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18631
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020505 Nonsense 73 1026 3 25
Genomic Location:
Chromosome 6 (position 36796347)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCAGATATGAGATAAGTGAGATGTCATGCTCTGCTGTAGACCATCTYTT[T/A]GCTGGCGTATGCTCGAGGAAGCCTTAAGATGAACGGGCCGTTCCTTGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8828
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020505 Nonsense 675 1026 18 25
ENSDART00000020505 Nonsense 675 1026 18 25
Genomic Location:
Chromosome 6 (position 36814255)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCCTTTGTCTTTCRTTGRCAGGATGGCATGGTGGGACTCATGTGGSTA[C/A]AGATCACTGTGTTTGCCAYGCGTCGACAGTGAGGGTGAAGATATGGAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9462
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020505 Nonsense 675 1026 18 25
ENSDART00000020505 Nonsense 675 1026 18 25
Genomic Location:
Chromosome 6 (position 36814255)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCCTTTGTCTTTCRTTGRCAGGATGGCATGGTGGGACTCATGTGGSTA[C/A]AGATCACTGTGTTTGCCAYGCGTCGACAGTGAGGGTGAAGATATGGAGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5b6ugymj