fut8

Ensembl ID:
ENSDARG00000015449
ZFIN ID:
ZDB-GENE-031118-20
Description:
alpha-(1,6)-fucosyltransferase [Source:RefSeq peptide;Acc:NP_001003855]
Human Orthologue:
FUT8
Human Description:
fucosyltransferase 8 (alpha (1,6) fucosyltransferase) [Source:HGNC Symbol;Acc:4019]
Mouse Orthologue:
Fut8
Mouse Description:
fucosyltransferase 8 Gene [Source:MGI Symbol;Acc:MGI:1858901]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15698 Essential Splice Site Available for shipment Available now
sa14786 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15698
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027688 Essential Splice Site 68 581 2 9
ENSDART00000132294 Essential Splice Site 68 581 4 11
Genomic Location:
Chromosome 17 (position 34070920)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATATTTTCTGGCAAGGGTTGTGCTAATGTGTCCCTCTCTCTGTCCTCCA[G/T]GTTACCTGATGGTCAAGCCGATGGTGGTCCGGGAGCTGTGGGTAAATTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14786
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027688 Nonsense 419 581 7 9
ENSDART00000132294 Nonsense 419 581 9 11
Genomic Location:
Chromosome 17 (position 34106387)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAACGGGTTTACCTCGCCACTGAKGACCCCTCACTACWGCAAGAGGCC[A/T]AGACCAAGTGAGTACAGTTCATCTAGTCTGTCTTATYCCAATTCAGTTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hq5m4har