lim2.4

Ensembl ID:
ENSDARG00000015445
ZFIN ID:
ZDB-GENE-040718-104
Description:
lens intrinsic membrane protein 2.4 [Source:RefSeq peptide;Acc:NP_001002407]
Human Orthologue:
LIM2
Human Description:
lens intrinsic membrane protein 2, 19kDa [Source:HGNC Symbol;Acc:6610]
Mouse Orthologue:
Lim2
Mouse Description:
lens intrinsic membrane protein 2 Gene [Source:MGI Symbol;Acc:MGI:104698]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4791 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4791
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104539 Essential Splice Site 58 197 2 6
ENSDART00000144923 Essential Splice Site 58 173 2 5
Genomic Location:
Chromosome 19 (position 11173026)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
KTGGAGGTACTGCATGGCCAACAAGTGTTACATGCAGACAGCAAGCATAG[G/A]TAAGTAAATTTATTTTAAATCAGTGTTMAATTTAAAGTCAGATTTAGTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/el2pnd7n