hdac1

Ensembl ID:
ENSDARG00000015427
ZFIN ID:
ZDB-GENE-020419-32
Description:
histone deacetylase 1 [Source:RefSeq peptide;Acc:NP_775343]
Human Orthologue:
HDAC1
Human Description:
histone deacetylase 1 [Source:HGNC Symbol;Acc:4852]
Mouse Orthologues:
Gm10093, Hdac1
Mouse Descriptions:
histone deacetylase 1 Gene [Source:MGI Symbol;Acc:MGI:108086]
predicted pseudogene 10093 Pseudogene [Source:MGI Symbol;Acc:MGI:3704479]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3005 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa3005
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051799 Nonsense 46 480 2 14
Genomic Location (Zv9):
Chromosome 19 (position 31056531)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 30223820
KASP Assay ID:
554-2564.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCATGAAGCCCCACAGAATCCGCATGACCCACAACCTTCTGCTCAACTA[T/A]GGGCTGTATAGGAAAATGGAGATTTATGTAAGGGAAATAAACAAATGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link