ppil1

Ensembl ID:
ENSDARG00000015422
ZFIN ID:
ZDB-GENE-051009-1
Description:
peptidyl-prolyl cis-trans isomerase-like 1 [Source:RefSeq peptide;Acc:NP_001029350]
Human Orthologue:
PPIL1
Human Description:
peptidylprolyl isomerase (cyclophilin)-like 1 [Source:HGNC Symbol;Acc:9260]
Mouse Orthologue:
Ppil1
Mouse Description:
peptidylprolyl isomerase (cyclophilin)-like 1 Gene [Source:MGI Symbol;Acc:MGI:1916066]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20778 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20778
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021406 Essential Splice Site 19 166 1 4
Genomic Location (Zv9):
Chromosome 6 (position 40582640)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40654240
KASP Assay ID:
2259-7916.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATACCGCCGGATTCATGGCAACCTCCTACTGTTTCGCTGGACACAACG[T/C]AAGTCGCAATGTGAATATTCGTTTTTAAATGAATTAGCCACGACTTCATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link