dhx15

Ensembl ID:
ENSDARG00000015392
ZFIN ID:
ZDB-GENE-030131-650
Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 15 [Source:RefSeq peptide;Acc:NP_001108613]
Human Orthologue:
DHX15
Human Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 15 [Source:HGNC Symbol;Acc:2738]
Mouse Orthologue:
Dhx15
Mouse Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 15 Gene [Source:MGI Symbol;Acc:MGI:1099786]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7108 Nonsense Confirmed mutation in F2 line During 2017
sa31622 Nonsense Available for shipment Available now
sa1420 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7108
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081245 Nonsense 118 769 2 14
Genomic Location (Zv9):
Chromosome 7 (position 73885191)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 71089278
KASP Assay ID:
554-5324.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTACGAGATCCTCAAGAAGAGGCTGCAGTTGCCCGTCTGGGAGTATAAA[G/T]AGCGCTTTAATGACATCCTGAACCGCCATCAGAGCTTTGTGCTCGTAGGA
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Entity Quality Tag
Larval:Protruding-mouth
ZFS:0000035
cranium
ZFA:0000737

malformed
PATO:0000646
abnormal
PATO:0000460
Larval:Protruding-mouth
ZFS:0000035
eye
ZFA:0000107

decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Protruding-mouth
ZFS:0000035
pericardium
ZFA:0000054

edematous
PATO:0001450
abnormal
PATO:0000460
Larval:Protruding-mouth
ZFS:0000035
trunk
ZFA:0001115
posterior-most
BSPO:0000037
curved dorsal
PATO:0001468
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa31622
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081245 Nonsense 208 769 3 14
Genomic Location (Zv9):
Chromosome 7 (position 73884053)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 71088140
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGGATACTCCATCAGATTCGAGGACTGTAGCTCTGCAAAGACCATACTA[A/T]AGTAAGTCATTGCTCTCAAATGATGTGTGTCATGAGCCTTCAATAAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1420
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081245 Nonsense 684 769 13 14
Genomic Location (Zv9):
Chromosome 7 (position 73838925)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 71043012
KASP Assay ID:
554-1341.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCGTGTCTTGTGTTATCAGGTTGCTCACCTGGAGCGCACCGGCCACTA[T/A]CTCACAGTGAAGGACAACCAGGTGGTCCAGTTGCACCCGTCCACCGTTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Myopia (pathological): A genome-wide association study provides evidence for association of chromosome 8p23 (MYP10) and 10q21.1 (MYP15) with high myopia in the French Population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link