ndufs3

Ensembl ID:
ENSDARG00000015385
ZFIN ID:
ZDB-GENE-050417-274
Description:
NADH dehydrogenase [Source:RefSeq peptide;Acc:NP_001017755]
Human Orthologue:
NDUFS3
Human Description:
NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase) [Source:HGNC Symbo
Mouse Orthologue:
Ndufs3
Mouse Description:
NADH dehydrogenase (ubiquinone) Fe-S protein 3 Gene [Source:MGI Symbol;Acc:MGI:1915599]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16724 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16724
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015682 Nonsense 139 255 5 7
Genomic Location (Zv9):
Chromosome 7 (position 39983826)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38320466
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAATCTGCTGTCCTTGCATTATAACTCTCGTATCCGAGTAAAGACCTA[C/A]ACGGATGAGCTGACTCCTCTTGACTCCTCTGTGCCTGTGTTCCAGGCGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link