FCHO1

Ensembl ID:
ENSDARG00000015356
Description:
FCH domain only 1 [Source:HGNC Symbol;Acc:29002]
Human Orthologue:
FCHO1
Human Description:
FCH domain only 1 [Source:HGNC Symbol;Acc:29002]
Mouse Orthologue:
Fcho1
Mouse Description:
FCH domain only 1 Gene [Source:MGI Symbol;Acc:MGI:1921265]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2424 Essential Splice Site Available for shipment Available now
sa21259 Nonsense Mutation detected in F1 DNA During 2014
sa6096 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8877 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2424
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029175 Essential Splice Site 65 895 3 32
Genomic Location:
Chromosome 8 (position 20579254)
KASP Assay ID:
554-2725.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTCCATGAGCAAACTGGCCAAGATGGCCAGCAATGGAAGCCCTCTGGG[G/A]TGAGTGACATCATTACTGTTATCATGATCCCTGTTCCRTCCCATTCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21259
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029175 Nonsense 486 895 18 32
Genomic Location:
Chromosome 8 (position 20597174)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCCTCTCTTGAGAATGTGGAGGATTCTGGACTGGATTCACCTTCTCAT[C/T]AGCCTCTTGGAGTTTCCCCTGATCCCACAGGATGGGCAGCCTGGCCGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6096
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029175 Essential Splice Site 576 895 22 32
Genomic Location:
Chromosome 8 (position 20601107)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTATAAAGTCAGAATTCTGAGTTATATGTGCTCACTCCATTTACAGTCA[G/T]TCGCCATAACAAGAAACTCAGAATATAACTCTGAATTCTGACTTTATAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8877
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029175 Nonsense 691 895 27 32
Genomic Location:
Chromosome 8 (position 20602731)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGCCAACCCCAATGCACCAGTGTTAAGCTTCAGACTGGTGAACATCTCT[C/T]GAGTCGACCACTTCTTACCCAACCAGAAGCTACTCTACAGGTCCAGTATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2jh9zdik