mfge8a

Ensembl ID:
ENSDARG00000015349
ZFIN ID:
ZDB-GENE-050327-9
Description:
milk fat globule-EGF factor 8 protein a isoform 2 [Source:RefSeq peptide;Acc:NP_001038241]
Human Orthologues:
F8, MFGE8
Human Descriptions:
coagulation factor VIII, procoagulant component [Source:HGNC Symbol;Acc:3546]
milk fat globule-EGF factor 8 protein [Source:HGNC Symbol;Acc:7036]
Mouse Orthologue:
Mfge8
Mouse Description:
milk fat globule-EGF factor 8 protein Gene [Source:MGI Symbol;Acc:MGI:102768]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8285 Nonsense Mutation detected in F1 DNA During 2014
sa18892 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8285
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015884 Nonsense 251 478 6 10
ENSDART00000132723 None None 118 None 5
ENSDART00000139400 Nonsense 251 473 6 10
Genomic Location:
Chromosome 7 (position 50250202)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTTTATCAARGCTTTCAAGGTGGCATCCAGTTTTGATGGCAAAACCTA[C/A]ACTGTGTACAGAGCAGATGGCCAGAGAAAAGACAGAGTAAGAAACAYCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18892
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015884 Nonsense 254 478 6 10
ENSDART00000132723 None None 118 None 5
ENSDART00000139400 Nonsense 254 473 6 10
Genomic Location:
Chromosome 7 (position 50250193)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGCTTTCAAGGTGGCATCCAGTTTTGATGGCAAAACCTACACTGTGTA[C/A]AGAGCAGATGGCCAGAGAAAAGACAGAGTAAGAAACATCGAAAATTTAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xmpx16y5