klhl8

Ensembl ID:
ENSDARG00000015344
ZFIN IDs:
ZDB-GENE-070209-226, ZDB-GENE-070209-226
Description:
kelch-like protein 8 [Source:RefSeq peptide;Acc:NP_001103950]
Human Orthologue:
KLHL8
Human Description:
kelch-like 8 (Drosophila) [Source:HGNC Symbol;Acc:18644]
Mouse Orthologue:
Klhl8
Mouse Description:
kelch-like 8 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2179430]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17652 Nonsense Available for shipment Available now
sa7244 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17652
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027066 Nonsense 330 604 5 11
ENSDART00000128089 Nonsense 330 604 4 10
Genomic Location:
Chromosome 21 (position 114845)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGACCCGTTCCGCAGCATCGAGTGCTACTCCATCAGTAAGAACAGCTG[G/A]TTCTTCGGGCCGGAAATGAACAGCAGGCGCAGGCATGTGGGAGTCATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7244
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027066 Essential Splice Site 350 604 5 11
ENSDART00000128089 Essential Splice Site 350 604 4 10
Genomic Location:
Chromosome 21 (position 114785)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGAAATGAACAGCAGGCGCAGGCATGTGGGAGTCATTTCAGTGGCAGG[T/G]GAGGAAGAGRAGGYGGGCAGGTGAACCAYGACYACAGACCCCAACACTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fns6kg8y