pgd

Ensembl ID:
ENSDARG00000015343
ZFIN ID:
ZDB-GENE-040426-2807
Description:
6-phosphogluconate dehydrogenase, decarboxylating isoform 1 [Source:RefSeq peptide;Acc:NP_998618]
Human Orthologue:
PGD
Human Description:
phosphogluconate dehydrogenase [Source:HGNC Symbol;Acc:8891]
Mouse Orthologue:
Pgd
Mouse Description:
phosphogluconate dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:97553]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24360 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24360
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017728 Nonsense 243 511 6 12
Genomic Location (Zv9):
Chromosome 23 (position 29635603)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 29466170
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTGAGGCCTATCATCTGATGAAGGACGTGCTTTGTATGAACCATGAT[G/T]AAATGGCTCAGGTCAGACATCCACTTCCTTCTTCAATTACTGTTCTATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Hepatocellular carcinoma: Genome-wide association study identifies 1p36.22 as a new susceptibility locus for hepatocellular carcinoma in chronic hepatitis B virus carriers. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link