psmc5

Ensembl ID:
ENSDARG00000015315
ZFIN ID:
ZDB-GENE-030131-6547
Description:
26S protease regulatory subunit 8 [Source:RefSeq peptide;Acc:NP_001003740]
Human Orthologue:
PSMC5
Human Description:
proteasome (prosome, macropain) 26S subunit, ATPase, 5 [Source:HGNC Symbol;Acc:9552]
Mouse Orthologue:
Psmc5
Mouse Description:
protease (prosome, macropain) 26S subunit, ATPase 5 Gene [Source:MGI Symbol;Acc:MGI:105047]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1912 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1912
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106191 Nonsense 182 406 6 12

The following transcripts of ENSDARG00000015315 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 11248797)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10131868
KASP Assay ID:
554-1902.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAACTTCCAGTCAAACACCCAGAATTGTTTGAAGCTCTTGGAATTGCA[C/T]AACCCAAGGCAAGTGACGGCACTGCACATTCTTATCTGGATAATTATGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link