klf12a

Ensembl ID:
ENSDARG00000015312
ZFIN ID:
ZDB-GENE-030131-9188
Description:
Kruppel-like factor 12 [Source:RefSeq peptide;Acc:NP_996945]
Human Orthologue:
KLF12
Human Description:
Kruppel-like factor 12 [Source:HGNC Symbol;Acc:6346]
Mouse Orthologue:
Klf12
Mouse Description:
Kruppel-like factor 12 Gene [Source:MGI Symbol;Acc:MGI:1333796]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa868 Essential Splice Site Confirmed mutation in F2 line During 2017
sa32708 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa868
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012873 Essential Splice Site 211 373 4 6
Genomic Location (Zv9):
Chromosome 1 (position 34178817)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 33813568
KASP Assay ID:
554-0770.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGTGCGCACATATTGTAAATCAACTCCCCCTACCTTTTGTTTTTATTC[A/G]GTGATGCACCGAATGGCAGATGGACTGTCACCGCGACGATCTCTGAGYGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32708
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012873 Nonsense 346 373 6 6
Genomic Location (Zv9):
Chromosome 1 (position 34188192)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 33822943
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACTGACGCGACATTACCGCAAACACACCGGCGTCAAACCGTTCAAATG[C/A]AGCGACTGTGACCGCAGTTTCTCCCGCTCGGACCACCTTGCCCTCCACCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Pancreatic cancer: A genome-wide association study identifies pancreatic cancer susceptibility loci on chromosomes 13q22.1, 1q32.1 and 5p15.33. (View Study)
  • Sphingolipid levels: Genome-wide association study identifies novel loci associated with circulating phospho- and sphingolipid concentrations. (View Study)
  • Ventricular conduction: Common variants in 22 loci are associated with QRS duration and cardiac ventricular conduction. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link