pitpnbl

Ensembl ID:
ENSDARG00000015310
ZFIN ID:
ZDB-GENE-040426-2791
Description:
phosphatidylinositol transfer protein, beta, like [Source:RefSeq peptide;Acc:NP_998608]
Human Orthologues:
PITPNB, PITPNM3
Human Descriptions:
phosphatidylinositol transfer protein, beta [Source:HGNC Symbol;Acc:9002]
PITPNM family member 3 [Source:HGNC Symbol;Acc:21043]
Mouse Orthologue:
Pitpnb
Mouse Description:
phosphatidylinositol transfer protein, beta Gene [Source:MGI Symbol;Acc:MGI:1927542]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10667 Missense, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10667
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042512 Nonsense 57 270 3 10
ENSDART00000104338 Nonsense 57 270 3 11
ENSDART00000132135 Missense 13 224 3 10
ENSDART00000145919 Missense 13 166 3 10
Genomic Location (Zv9):
Chromosome 3 (position 14955683)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15201289
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGTTCTCCGAAATGAACCTTACGAGAAGGAGGGCGAGAAGGGCCAGTA[C/A]ACCCACAAGAYTTACCACATACACAGGTGAGAATGAATGCGTGTGGATGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Obesity: A genome-wide association study on obesity and obesity-related traits. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link