plxnc1

Ensembl ID:
ENSDARG00000015278
ZFIN ID:
ZDB-GENE-030131-1620
Description:
Novel protein similar to vertebrate plexin C1 (PLXNC1) [Source:UniProtKB/TrEMBL;Acc:Q5RGW1]
Human Orthologue:
PLXNC1
Human Description:
plexin C1 [Source:HGNC Symbol;Acc:9106]
Mouse Orthologue:
Plxnc1
Mouse Description:
plexin C1 Gene [Source:MGI Symbol;Acc:MGI:1890127]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26277 Nonsense Mutation detected in F1 DNA During 2017
sa13332 Nonsense Available for shipment Available now
sa1749 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa26277
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004222 Nonsense 183 1252 5 33
ENSDART00000135735   None 1056 None 27
Genomic Location (Zv9):
Chromosome 4 (position 17383195)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18326035
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTAAGTGCTGTTGCTGTTTTTATCTAGATGTTCCACACATGATGAATG[C/A]TCAAATTCCTCATGGGTGTCCATTCCAAAAGACTCTCTTCAGACAGAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13332
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004222 Nonsense 396 1252 11 33
ENSDART00000135735 Nonsense 202 1056 6 27
Genomic Location (Zv9):
Chromosome 4 (position 17381526)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18324366
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGRAAYCTGGAMTCTGTCACYAAARTCCGTATTCAGGGGGATCTGGRCTG[T/A]ATTGCTAAAGAGTGAGACTGTGTGTCTGTGTTCAGTGATGTACWGWAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1749
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004222 Nonsense 977 1252 24 33
ENSDART00000135735 Nonsense 775 1056 19 27
Genomic Location (Zv9):
Chromosome 4 (position 17363989)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18306829
KASP Assay ID:
554-1742.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTCAGAAATTCGAGGGCACGTTACCATGTTAAACACTCTGAAACATTA[T/A]CAGGTGAGTCCATGACAACAAAACATGGTGTAAACATGACCATGTTTGAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link