plcb4

Ensembl ID:
ENSDARG00000015257
ZFIN ID:
ZDB-GENE-060627-1
Description:
Plcb4 protein [Source:UniProtKB/TrEMBL;Acc:Q6NW48]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38208 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38208
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053894 Essential Splice Site 70 148 3 6
Genomic Location (Zv9):
Chromosome Zv9_NA689 (position 30708)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150493.1 30708
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTCTGTGGTCAATCAGGTGAACATCGAAGACTTAAAGCAGATGAAGG[T/C]AAATGTTCTGAGTCAGTTCATCAGGTCTCACTGATTTGTTTGACGGTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link