fzr1

Ensembl ID:
ENSDARG00000015254
ZFIN ID:
ZDB-GENE-040426-712
Description:
fizzy-related protein homolog [Source:RefSeq peptide;Acc:NP_956547]
Human Orthologue:
FZR1
Human Description:
fizzy/cell division cycle 20 related 1 (Drosophila) [Source:HGNC Symbol;Acc:24824]
Mouse Orthologue:
Fzr1
Mouse Description:
fizzy/cell division cycle 20 related 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1926790]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25392 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa21265 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25392
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015891 None None 495 None 14
ENSDART00000146989 Splice Site, Nonsense 5 109 2 5
Genomic Location:
Chromosome 8 (position 21401865)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGACTTACACCCTTCTGCCTCGTTAATCAGCAAACAAATGACCATACTT[C/T]AAGTGTAGACCTTTAACTATTCATGTACATCATCATGACCTTCTAAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21265
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015891 Nonsense 9 495 2 14
ENSDART00000146989 Nonsense 30 109 3 5
Genomic Location:
Chromosome 8 (position 21402029)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCCATATTTTAGAATAACATCCATGGATCAGGACTATGAGCGCCGGT[T/G]ACTGCGGCAGATCAACGTCCAAAATGACAACACCAGCCCTATGGTTAGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/s3jigvhd