fzr1

Ensembl ID:
ENSDARG00000015254
ZFIN ID:
ZDB-GENE-040426-712
Description:
fizzy-related protein homolog [Source:RefSeq peptide;Acc:NP_956547]
Human Orthologue:
FZR1
Human Description:
fizzy/cell division cycle 20 related 1 (Drosophila) [Source:HGNC Symbol;Acc:24824]
Mouse Orthologue:
Fzr1
Mouse Description:
fizzy/cell division cycle 20 related 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1926790]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25392 Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa21265 Nonsense Mutation detected in F1 DNA During 2016
sa34376 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa25392
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015891   None 495 None 14
ENSDART00000146989 Splice Site, Nonsense 5 109 2 5
Genomic Location (Zv9):
Chromosome 8 (position 21401865)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20831762
KASP Assay ID:
554-7525.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGACTTACACCCTTCTGCCTCGTTAATCAGCAAACAAATGACCATACTT[C/T]AAGTGTAGACCTTTAACTATTCATGTACATCATCATGACCTTCTAAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21265
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015891 Nonsense 9 495 2 14
ENSDART00000146989 Nonsense 30 109 3 5
Genomic Location (Zv9):
Chromosome 8 (position 21402029)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20831926
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCCATATTTTAGAATAACATCCATGGATCAGGACTATGAGCGCCGGT[T/G]ACTGCGGCAGATCAACGTCCAAAATGACAACACCAGCCCTATGGTTAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34376
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015891 Nonsense 54 495 3 14
ENSDART00000146989 Nonsense 75 109 4 5
Genomic Location (Zv9):
Chromosome 8 (position 21403618)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20833515
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCACCATTGTCATCGCCAAGCAAACATGGGGACAGATTTATACCATCC[C/T]GAGCTGGGGCCAACTGGAGCATCAATTTCCACAGAATAAATGTAGGTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link