ENSDARG00000015247

Ensembl ID:
ENSDARG00000015247
Mouse Orthologue:
F8
Mouse Description:
coagulation factor VIII Gene [Source:MGI Symbol;Acc:MGI:88383]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2770 Nonsense Mutation detected in F1 DNA During 2014
sa15845 Essential Splice Site Available for shipment Available now
sa22404 Missense Mutation detected in F1 DNA During 2014
sa7229 Nonsense Mutation detected in F1 DNA During 2014
sa5870 Nonsense Mutation detected in F1 DNA During 2014
sa19072 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2770
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014159 Nonsense 275 2147 7 37
Genomic Location:
Chromosome 14 (position 1012497)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGTTCGCTCAGGTCTGAGTGTGTGTGAGAAGAGTCCGCAGGTCTCCTG[G/A]CACCTCATAGGTCTGGGCTCCAGTCCTGASATCCACAGCATCCAGTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15845
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014159 Essential Splice Site 338 2147 8 37
Genomic Location:
Chromosome 14 (position 1012866)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATMAACTCAGGCTGATGGAAACCYAATGCATGYCTCTGTGTTGTTCTCC[A/G]GCKGGTATGAATGCGTTCTTCACTGTTGAAAACTGTCCTGAACCYGCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22404
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014159 Missense 508 2147 10 37
Genomic Location:
Chromosome 14 (position 1015699)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATCCAAACGGCCTGACCAGCGTTCAGCCTCTGAAGACAACAAACAAAG[G/A]TATGAACCACGGTGGCTCAGTGGTGAGCACTGAAGAAGCAAGAAGGTCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7229
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014159 Nonsense 929 2147 17 37
ENSDART00000014159 Nonsense 929 2147 17 37
Genomic Location:
Chromosome 14 (position 1019096)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGACRGCGCTCTAGGCTAGTTATGAACAGTACAAGGCACAGTAGATG[G/A]CGCTCTAKGCTAGTTTTTAACAGCAGACAGTGCTCTAGGYTAGTTATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5870
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014159 Nonsense 929 2147 17 37
ENSDART00000014159 Nonsense 929 2147 17 37
Genomic Location:
Chromosome 14 (position 1019096)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGACRGCGCTCTAGGCTAGTTATGAACAGTACAAGGCACAGTAGATG[G/A]CGCTCTAGGCTAGTTTTTAACAGCAGACAGTGCTCTAGGYTAGTTATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19072
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014159 Nonsense 1836 2147 31 37
Genomic Location:
Chromosome 14 (position 1031672)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTGTATAGTTGGAGGCCTAAACTGATTTTTGTTTTAACAGAATGCAAT[C/T]AGCCCATAGGAATGCAATCAAGATGGATCACCAACAAACAAATAACAGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xwo5zkba