cdkl5

Ensembl ID:
ENSDARG00000015240
ZFIN IDs:
ZDB-GENE-081022-110, ZDB-GENE-081022-110
Description:
cyclin-dependent kinase-like 5 isoform 1 [Source:RefSeq peptide;Acc:NP_001139240]
Human Orthologue:
CDKL5
Human Description:
cyclin-dependent kinase-like 5 [Source:HGNC Symbol;Acc:11411]
Mouse Orthologue:
Cdkl5
Mouse Description:
cyclin-dependent kinase-like 5 Gene [Source:MGI Symbol;Acc:MGI:1278336]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24892 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21938 Nonsense Available for shipment Available now
sa16950 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24892
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010026 Essential Splice Site 276 1039 10 17
ENSDART00000127502 Essential Splice Site 276 1080 10 18
Genomic Location:
Chromosome 11 (position 31091768)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTGTTCTACTGTGGCACGACTCTCCTCAATGCGTTTTTTACTGCACCA[G/A]AACCTGCTGTGCCTGAACCCTACCGAACGCTTTCTGACAGAGCAGTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21938
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010026 Nonsense 528 1039 11 17
ENSDART00000127502 Nonsense 528 1080 11 18
Genomic Location:
Chromosome 11 (position 31094681)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTAGCAGAGACACGACTCCACCTGGATGATCCTATGGCAGGATCCGGTT[C/A]AGGCTCTCGATATTTCCCGTCCAGCTGCCTGGATCTAAACGCAGCTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16950
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010026 Essential Splice Site 730 1039 12 17
ENSDART00000127502 Essential Splice Site 730 1080 12 18
Genomic Location:
Chromosome 11 (position 31095672)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGACKAGGGACAACACAGCTACCTTCCACACACAACGCCCAAAAAACGAG[G/A]TCCGAGGTCTCAGCAGGACCCTCAGAAMGCGTCCACTCAYACACTCAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ojjuezom