cdkl5

Ensembl ID:
ENSDARG00000015240
ZFIN IDs:
ZDB-GENE-081022-110, ZDB-GENE-081022-110
Description:
cyclin-dependent kinase-like 5 isoform 1 [Source:RefSeq peptide;Acc:NP_001139240]
Human Orthologue:
CDKL5
Human Description:
cyclin-dependent kinase-like 5 [Source:HGNC Symbol;Acc:11411]
Mouse Orthologue:
Cdkl5
Mouse Description:
cyclin-dependent kinase-like 5 Gene [Source:MGI Symbol;Acc:MGI:1278336]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24892 Essential Splice Site Mutation detected in F1 DNA During 2016
sa35110 Nonsense Mutation detected in F1 DNA During 2016
sa21938 Nonsense Available for shipment Available now
sa16950 Essential Splice Site Available for shipment Available now
sa35111 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa24892
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010026 Essential Splice Site 276 1039 10 17
ENSDART00000127502 Essential Splice Site 276 1080 10 18
Genomic Location (Zv9):
Chromosome 11 (position 31091768)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29969130
KASP Assay ID:
554-7656.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTGTTCTACTGTGGCACGACTCTCCTCAATGCGTTTTTTACTGCACCA[G/A]AACCTGCTGTGCCTGAACCCTACCGAACGCTTTCTGACAGAGCAGTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35110
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010026 Nonsense 491 1039 11 17
ENSDART00000127502 Nonsense 491 1080 11 18
Genomic Location (Zv9):
Chromosome 11 (position 31094570)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29971932
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGTCCTCACACGGATCCATGCCTTCCACGTCCTCCTCCAAAAGCTCCT[C/A]ATCCTTCCTCAGCTTGTCCAAAAGCCACGGCGCACTTAATGACGCCAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21938
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010026 Nonsense 528 1039 11 17
ENSDART00000127502 Nonsense 528 1080 11 18
Genomic Location (Zv9):
Chromosome 11 (position 31094681)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29972043
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTAGCAGAGACACGACTCCACCTGGATGATCCTATGGCAGGATCCGGTT[C/A]AGGCTCTCGATATTTCCCGTCCAGCTGCCTGGATCTAAACGCAGCTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16950
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010026 Essential Splice Site 730 1039 12 17
ENSDART00000127502 Essential Splice Site 730 1080 12 18
Genomic Location (Zv9):
Chromosome 11 (position 31095672)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29973034
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGACKAGGGACAACACAGCTACCTTCCACACACAACGCCCAAAAAACGAG[G/A]TCCGAGGTCTCAGCAGGACCCTCAGAAMGCGTCCACTCAYACACTCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35111
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010026 Nonsense 770 1039 14 17
ENSDART00000127502 Nonsense 770 1080 14 18
Genomic Location (Zv9):
Chromosome 11 (position 31098361)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29975723
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGTTCATTCAGGGATGTATTTGTTGTTTTTTTGTGTAGTCCCATCTCCT[C/T]GACCTGACAACACGTTTCTTGAGACCACTGGACAGAGCAGAGTGCAAGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link