prp19

Ensembl ID:
ENSDARG00000015239
ZFIN ID:
ZDB-GENE-030131-263
Description:
pre-mRNA-processing factor 19 [Source:RefSeq peptide;Acc:NP_958875]
Human Orthologue:
PRPF19
Human Description:
PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:17896]
Mouse Orthologue:
Prpf19
Mouse Description:
PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:106

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15907 Nonsense Available for shipment Available now
sa22437 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15907
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106593 Nonsense 166 505 6 16
Genomic Location (Zv9):
Chromosome 14 (position 13977291)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 15987872
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTCTGTTTTCATAGGGTGCTGGTGGTGAGGCCATGGAGGTCAGTGAA[C/T]AGGTTGGAATGACTCCGGAGATCAWACAGAAGGTTTGTGAATCCACAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22437
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106593 Nonsense 321 505 11 16
Genomic Location (Zv9):
Chromosome 14 (position 13980255)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 15990844
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCATGAGTCTGCTGTTACTGGCCTCTCTCTGCACGCTACTGGGGACTA[T/A]TTACTGAGCTCATCTGAGGACCAGGTAACACACACACACACAATTGTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link