pycrl

Ensembl ID:
ENSDARG00000015236
ZFIN ID:
ZDB-GENE-041014-244
Description:
Pyrroline-5-carboxylate reductase 3 [Source:UniProtKB/Swiss-Prot;Acc:Q5SPD7]
Human Orthologue:
PYCRL
Human Description:
pyrroline-5-carboxylate reductase-like [Source:HGNC Symbol;Acc:25846]
Mouse Orthologue:
Pycrl
Mouse Description:
pyrroline-5-carboxylate reductase-like Gene [Source:MGI Symbol;Acc:MGI:1913444]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16640 Essential Splice Site Available for shipment Available now
sa25147 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa16640
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002787 Essential Splice Site 41 288 2 7
Genomic Location (Zv9):
Chromosome 20 (position 52870930)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 52723777
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGCGGGAAACATGGCGTYTGGCGTCGCGCAGGGAATCATCGCCTCAGG[T/G]CAACAAATACCYGACAGTACMTTAAATARCTGCATTATATCAACAGTTCY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25147
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002787 Nonsense 93 288 4 7
Genomic Location (Zv9):
Chromosome 20 (position 52874590)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 52727437
KASP Assay ID:
554-7367.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGAGGCTCTCGTTTGATCTTTCTGGCTGTCAAACCTCACATCATTCCA[C/T]AAGTCCTAAAAGAAATCTCACAGGAAGTCACCAAGGAACACATCATCGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link