ero1l

Ensembl ID:
ENSDARG00000015228
ZFIN ID:
ZDB-GENE-040426-1312
Description:
ERO1-like protein alpha [Source:UniProtKB/Swiss-Prot;Acc:Q7T3D1]
Human Orthologue:
ERO1L
Human Description:
ERO1-like (S. cerevisiae) [Source:HGNC Symbol;Acc:13280]
Mouse Orthologue:
Ero1l
Mouse Description:
ERO1-like (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1354385]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36359 Nonsense Mutation detected in F1 DNA During 2017
sa32137 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36359
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012877 Nonsense 124 489 5 16
ENSDART00000109190 Nonsense 124 488 5 17
ENSDART00000142941 Nonsense 120 457 5 16
Genomic Location (Zv9):
Chromosome 17 (position 14868687)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15019515
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTGTTCTACAGTATTCAGAAAAGGCTAGTCATGATACTGAGGAATGC[G/T]AGAAGGCGGAGAAGCTTGGAGCTGTCAATGGTTCTCTGAGGTAAAACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32137
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012877 Essential Splice Site 366 489 12 16
ENSDART00000109190 Essential Splice Site 366 488 13 17
ENSDART00000142941 Essential Splice Site 362 457 13 16
Genomic Location (Zv9):
Chromosome 17 (position 14863133)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15013961
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAGACTGCTCTATTTGCTGGAAATAACAAGGAAGCCATGAAACTGAAGG[T/C]AAGTTTGTCTTTTCCAAATGTACATTAATGTTACAGAACCACACATATTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link