cbll1

Ensembl ID:
ENSDARG00000015222
ZFIN ID:
ZDB-GENE-040426-691
Description:
Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1 [Source:RefSeq peptide;Acc:NP_9
Human Orthologues:
CBLL1, ZNF645
Human Descriptions:
Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1 [Source:HGNC Symbol;Acc:21225]
zinc finger protein 645 [Source:HGNC Symbol;Acc:26371]
Mouse Orthologue:
Cbll1
Mouse Description:
Casitas B-lineage lymphoma-like 1 Gene [Source:MGI Symbol;Acc:MGI:2144842]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2169 Essential Splice Site F2 line generated During 2016

Mutation Details

Allele Name:
sa2169
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015834 Essential Splice Site None 405 1 7
ENSDART00000066978 Essential Splice Site None 475 1 6
ENSDART00000066979   None 482 None 6
ENSDART00000140722   None 202 None 6
Genomic Location (Zv9):
Chromosome 4 (position 17908622)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18851462
KASP Assay ID:
554-3249.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGATYGACTCGAGGGTAAAAACCAAGTTGTTTTYACCCTACTTCCTCAG[G/A]TAATTGATAGCATTAAAAATTACAGACATAATTGTTTTAATTTTTATTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link