ccdc55

Ensembl ID:
ENSDARG00000015221
ZFIN ID:
ZDB-GENE-030131-2646
Description:
Coiled-coil domain-containing protein 55 [Source:UniProtKB/Swiss-Prot;Acc:Q568R1]
Human Orthologue:
CCDC55
Human Description:
coiled-coil domain containing 55 [Source:HGNC Symbol;Acc:25305]
Mouse Orthologue:
Ccdc55
Mouse Description:
coiled-coil domain containing 55 Gene [Source:MGI Symbol;Acc:MGI:2144305]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4965 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4965
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003221 Nonsense 154 516 5 7

The following transcripts of ENSDARG00000015221 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 39243069)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAAGAAGCCTTTGTCACATCAGCTTATCGCCAAAAGCTTAAAGAAAGA[C/T]AGGAGGAGTTGGAGAGAGAGAAGAGGGAAGCAGAGTTGGAAGGTGAGTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4232qr9e