rbb4l

Ensembl ID:
ENSDARG00000015208
ZFIN ID:
ZDB-GENE-030131-848
Description:
Histone-binding protein RBBP7 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZTY4]
Human Orthologue:
RBBP4
Human Description:
retinoblastoma binding protein 4 [Source:HGNC Symbol;Acc:9887]
Mouse Orthologue:
Rbbp4
Mouse Description:
retinoblastoma binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1194912]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10742 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10742
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008144 Nonsense 75 448 3 13
ENSDART00000081335 Nonsense 75 425 3 12
ENSDART00000131059 Nonsense 75 426 3 13
ENSDART00000142481 Nonsense 75 426 3 12

The following transcripts of ENSDARG00000015208 do not overlap with this mutation:

Genomic Location:
Chromosome 11 (position 12809695)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGACTATGTGGTTCACCGGCTGGTGTTGGGCACACACACTTCAGAYGAG[C/T]AAAACCATCTGGTCATCGCCAGTGTTCAGATCCCCAATGATGACGCTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n210damc