pcmt

Ensembl ID:
ENSDARG00000015201
ZFIN ID:
ZDB-GENE-990415-134
Description:
Protein-L-isoaspartate(D-aspartate) O-methyltransferase [Source:UniProtKB/Swiss-Prot;Acc:Q92047]
Human Orthologue:
PCMT1
Human Description:
protein-L-isoaspartate (D-aspartate) O-methyltransferase [Source:HGNC Symbol;Acc:8728]
Mouse Orthologue:
Pcmt1
Mouse Description:
protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:97502]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8979 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8979
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092718 Essential Splice Site 19 228 None 9
ENSDART00000144288 Essential Splice Site 57 266 None 8
Genomic Location (Zv9):
Chromosome 20 (position 1337601)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 1293466
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAAATCCGGAGGAGYGAGCCACGCAGAGCTCGTCAACAACCTCCGCAG[T/A]GAGTTTAACCCRCACCGACTGTCCAAGAGAGCGGGATGGGTCTGTGTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link