cblb

Ensembl ID:
ENSDARG00000015199
ZFIN ID:
ZDB-GENE-030616-417
Description:
Novel protein similar to vertebrate Cas-Br-M (Murine) ecotropic retroviral transforming sequence (CB
Human Orthologue:
CBLB
Human Description:
Cas-Br-M (murine) ecotropic retroviral transforming sequence b [Source:HGNC Symbol;Acc:1542]
Mouse Orthologue:
Cblb
Mouse Description:
Casitas B-lineage lymphoma b Gene [Source:MGI Symbol;Acc:MGI:2146430]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21758 Splice Site, Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21758
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047776 Splice Site, Nonsense 856 939 17 18
ENSDART00000137508 Splice Site, Nonsense 851 934 18 19
Genomic Location:
Chromosome 10 (position 29409280)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGACGCCGTTCAGGGCCCCGCAAGACTACGATCAGCTGCCGCCCACAT[C/A]AGGTATTACACACTGAATAAAGGCTGTAGATTGTTCTTTGTCTTTACATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hr1baybm