LOC572079

Ensembl ID:
ENSDARG00000015184
Human Orthologue:
MPP3
Human Description:
membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3) [Source:HGNC Symbol;Acc:7221]
Mouse Orthologue:
Mpp3
Mouse Description:
membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3) Gene [Source:MGI Symbol;Acc:MGI:132

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11531 Essential Splice Site Available for shipment Available now
sa8934 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20085 Nonsense Mutation detected in F1 DNA During 2014
sa6907 Nonsense Mutation detected in F1 DNA During 2014
sa20084 Nonsense Mutation detected in F1 DNA During 2014
sa854 Essential Splice Site F2 line generated During 2014
sa13793 Nonsense Available for shipment Available now
sa12062 Essential Splice Site Available for shipment Available now
sa6042 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11531
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012159 Essential Splice Site 48 586 2 18
Genomic Location:
Chromosome 3 (position 38677891)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCCTCAGGGATGTTTTCAGTGAGAGGAGYCTCAGCTGCCTGATGAAGG[T/C]GGGCTTGTGAGTTTTMTGCAGTATTTTGAATTKACTTTGAATTTGCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8934
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012159 Essential Splice Site 74 586 3 18
Genomic Location:
Chromosome 3 (position 38675765)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGAGCCCCACCCCGGTTCTCCACAGTGCCTCCACGCTGGCAGAGGATG[T/A]AAGTGCTACAGCCTTACATATCACATCANNNNNNNNNAGATTAATGATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20085
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012159 Nonsense 105 586 5 18
Genomic Location:
Chromosome 3 (position 38673949)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACTAATTGTGCCTGTTCATGTCCCTTCTGGATATTAGGCGGTTTTGT[C/A]AGTTCATGACACAGTGGCACAGAAGAACTTTGACCCTGTGCTGCCTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6907
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012159 Nonsense 271 586 9 18
Genomic Location:
Chromosome 3 (position 38668380)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACGTGGRGACGTCCTGCAGGTGGTCAGTCAGGATGATCAGACATGGTG[G/A]CAAGCCAAGAGAATTGGTGACTGCAAYCTTCGTGCAGGACTYGTCCCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20084
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012159 Nonsense 299 586 10 18
Genomic Location:
Chromosome 3 (position 38667121)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGTTTGAAGCTCTCCTCATGTGCTTTTCCCCTCAGGCGCTTGGCCTAC[A/T]GAATAAAAATGGGCACTCTTCAAAACTCCAAATCTCCCAAAAAAGCTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa854
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012159 Essential Splice Site 449 586 15 18
Genomic Location:
Chromosome 3 (position 38651131)
KASP Assay ID:
554-0757.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCACTTTGTGACTAAGCAGGCCTTTGATGCAGATGCACAGAATAACAAG[T/A]AAGAGATGCTGTGATGTGCTACTGCTAAATAAGTTTCATCCATTTGTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13793
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012159 Nonsense 474 586 16 18
Genomic Location:
Chromosome 3 (position 38650974)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGAATCTGTATGGGACCAGTATAGAGGCCAWCCGCTCGGTTCAAGCC[A/T]AAAACAAGAWGTGTCTTGTAGATGTACAGCCAGAGSTAAATTAATGCWGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12062
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012159 Essential Splice Site 485 586 16 18
Genomic Location:
Chromosome 3 (position 38650938)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCGGTTCAAGCCWAAAACAAGAWGTGTCTTGTAGATGTACAGCCAGAG[G/C]TAAATTAATGCWGTACTTGCCCTYAGAGTTGATTAAAWCCTCWAAACTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6042
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012159 Nonsense 545 586 18 18
Genomic Location:
Chromosome 3 (position 38645816)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGGAGGACCTACAGGAAATGCGTCTGTCKGCGCAGCAGATCGATCAA[C/T]AGTACGGTCACCTCGTGGATCGGGTCCTGATCAARGAGGACACTGCCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kfenplp5