mfsd8

Ensembl ID:
ENSDARG00000015179
ZFIN ID:
ZDB-GENE-060818-29
Description:
Major facilitator superfamily domain-containing protein 8 [Source:UniProtKB/Swiss-Prot;Acc:Q0VA82]
Human Orthologue:
MFSD8
Human Description:
major facilitator superfamily domain containing 8 [Source:HGNC Symbol;Acc:28486]
Mouse Orthologue:
Mfsd8
Mouse Description:
major facilitator superfamily domain containing 8 Gene [Source:MGI Symbol;Acc:MGI:1919425]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2646 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa2646
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050074 Essential Splice Site 176 504 5 12
Genomic Location:
Chromosome 12 (position 23984737)
KASP Assay ID:
554-3004.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGGCAAACATGAGTGCCTGTCAAGCTCTCGGCTTTATACTTGGCCCAG[G/A]TCTGTGTAAAGTATTTAAAGCATGTTACTTGCAGTATATTGCAAAAATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/k93mk8k9