mfsd8

Ensembl ID:
ENSDARG00000015179
ZFIN ID:
ZDB-GENE-060818-29
Description:
Major facilitator superfamily domain-containing protein 8 [Source:UniProtKB/Swiss-Prot;Acc:Q0VA82]
Human Orthologue:
MFSD8
Human Description:
major facilitator superfamily domain containing 8 [Source:HGNC Symbol;Acc:28486]
Mouse Orthologue:
Mfsd8
Mouse Description:
major facilitator superfamily domain containing 8 Gene [Source:MGI Symbol;Acc:MGI:1919425]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42028 Nonsense Mutation detected in F1 DNA During 2016
sa27950 Nonsense Mutation detected in F1 DNA During 2016
sa2646 Essential Splice Site F2 line generated During 2016

Mutation Details

Allele Name:
sa42028
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050074 Nonsense 77 504 4 12
Genomic Location:
Chromosome 12 (position 23983934)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAAGTGCAGATGCCAGTTTTTTGGGATGGGTGGTTGCTGCATACAGTT[T/A]GGGTCAGATGGTGGCCTCACCCTTCTTTGGATTGTGGTCCAATCACAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27950
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050074 Nonsense 137 504 4 12
Genomic Location:
Chromosome 12 (position 23984113)
KASP Assay ID:
2260-5356.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCACACAACCAGATTCACATGCTCTTGGCTCGCACATTTGTGGGTATC[G/T]GAGCAGGTAAAAAGACTTTTTTTTGAAAGAATTTAATACATGCATGTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2646
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050074 Essential Splice Site 176 504 5 12
Genomic Location:
Chromosome 12 (position 23984737)
KASP Assay ID:
554-3004.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGGCAAACATGAGTGCCTGTCAAGCTCTCGGCTTTATACTTGGCCCAG[G/A]TCTGTGTAAAGTATTTAAAGCATGTTACTTGCAGTATATTGCAAAAATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link