ror1

Ensembl ID:
ENSDARG00000015176
ZFIN ID:
ZDB-GENE-030131-6104
Description:
Novel protein similar to vertebrate receptor tyrosine kinase-like orphan receptor 1 (ROR1) [Source:U
Human Orthologue:
ROR1
Human Description:
receptor tyrosine kinase-like orphan receptor 1 [Source:HGNC Symbol;Acc:10256]
Mouse Orthologue:
Ror1
Mouse Description:
receptor tyrosine kinase-like orphan receptor 1 Gene [Source:MGI Symbol;Acc:MGI:1347520]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12160 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12160
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065172 Nonsense 675 950 9 9
ENSDART00000132280 Nonsense 639 914 8 8
Genomic Location:
Chromosome 6 (position 31466745)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCAACACCCTCCTCCCTATTCGCTGGATGCCACCAGAGGCCATAGTTTA[T/A]GGGAAATACAGCACAGATTCTGACGTTTGGGCGTTTGGTGTGGTTTTATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jor3jhxt