ror1

Ensembl ID:
ENSDARG00000015176
ZFIN ID:
ZDB-GENE-030131-6104
Description:
Novel protein similar to vertebrate receptor tyrosine kinase-like orphan receptor 1 (ROR1) [Source:U
Human Orthologue:
ROR1
Human Description:
receptor tyrosine kinase-like orphan receptor 1 [Source:HGNC Symbol;Acc:10256]
Mouse Orthologue:
Ror1
Mouse Description:
receptor tyrosine kinase-like orphan receptor 1 Gene [Source:MGI Symbol;Acc:MGI:1347520]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31514 Nonsense Available for shipment Available now
sa40718 Essential Splice Site Mutation detected in F1 DNA During 2016
sa12160 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31514
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065172 Nonsense 97 950 3 9
ENSDART00000132280 Nonsense 61 914 2 8
Genomic Location (Zv9):
Chromosome 6 (position 31515761)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 31836677
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGAGTTGCATTGCCACGTTTCGGGGACTCCATCACCCTCAGTCCGCTG[G/A]CTTAAAAACGATGCCCCTGTGGTTCAGGAGCCACGGCGGGTCTCGTACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40718
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065172 Essential Splice Site 157 950 3 9
ENSDART00000132280 Essential Splice Site 121 914 2 8
Genomic Location (Zv9):
Chromosome 6 (position 31515581)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 31836497
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGCTATGGCACAGTGTCAACCACAGGAATCCTGTTTGTCAAGTTTGG[T/G]GAGTGATTTTTAGAACTTTAGAATGAGAAAAAAGCTTAATTAAACACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12160
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065172 Nonsense 675 950 9 9
ENSDART00000132280 Nonsense 639 914 8 8
Genomic Location (Zv9):
Chromosome 6 (position 31466745)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 31787661
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCAACACCCTCCTCCCTATTCGCTGGATGCCACCAGAGGCCATAGTTTA[T/A]GGGAAATACAGCACAGATTCTGACGTTTGGGCGTTTGGTGTGGTTTTATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link