abcd3a

Ensembl ID:
ENSDARG00000015167
ZFIN ID:
ZDB-GENE-040426-2868
Description:
ATP-binding cassette sub-family D member 3 [Source:RefSeq peptide;Acc:NP_998647]
Human Orthologue:
ABCD3
Human Description:
ATP-binding cassette, sub-family D (ALD), member 3 [Source:HGNC Symbol;Acc:67]
Mouse Orthologue:
Abcd3
Mouse Description:
ATP-binding cassette, sub-family D (ALD), member 3 Gene [Source:MGI Symbol;Acc:MGI:1349216]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17682 Essential Splice Site Available for shipment Available now
sa19344 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17682
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019318 Essential Splice Site 438 656 15 23

The following transcripts of ENSDARG00000015167 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 31225641)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTGGTGCCTGGAAGTGGAAGAATCATCAACATAGACAATATCRTCAAG[T/C]AAGAGTGGCTTCTCTCTGTCGCTGTATTTCAGTTTGGTGAACTATTTAWA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19344
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019318 Essential Splice Site 577 656 20 23

The following transcripts of ENSDARG00000015167 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 31229380)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGGACTGGATGGATGTGCTCAGTGGAGGAGAGAAGCAGAGAATGGCGG[T/G]AAATTAAGACTTTTTCCAACCACAAACAGTAATGTAAATTGACTTTCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/oofgssed