fbln2

Ensembl ID:
ENSDARG00000015156
ZFIN ID:
ZDB-GENE-060711-1
Description:
Fbln2 protein [Source:UniProtKB/TrEMBL;Acc:Q5BLE3]
Human Orthologue:
FBLN2
Human Description:
fibulin 2 [Source:HGNC Symbol;Acc:3601]
Mouse Orthologue:
Fbln2
Mouse Description:
fibulin 2 Gene [Source:MGI Symbol;Acc:MGI:95488]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15910 Nonsense Available for shipment Available now
sa21928 Nonsense Available for shipment Available now
sa21929 Nonsense Mutation detected in F1 DNA During 2014
sa16218 Essential Splice Site Available for shipment Available now
sa812 Nonsense Available for shipment Available now
sa1922 Nonsense F2 line generated During 2014
sa8965 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15910
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024992 None None 468 None 10
ENSDART00000103481 Nonsense 240 328 1 2
ENSDART00000113707 None None 1231 None 33
ENSDART00000131752 None None 650 None 13
ENSDART00000132865 None None 207 None 5
ENSDART00000134504 None None 304 None 8

The following transcripts of ENSDARG00000015156 do not overlap with this mutation:

Genomic Location:
Chromosome 11 (position 28154111)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATATGAGAAAAATAGATGARAAAGAGGAGGATGAGGAAGACTATGATTA[T/A]CCACCCACTGAYTACTCAGCTCCTTCTCATGATGATTTTGCGGCTCCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21928
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024992 None None 468 None 10
ENSDART00000103481 None None 328 None 2
ENSDART00000113707 Nonsense 293 1231 4 33
ENSDART00000131752 None None 650 None 13
ENSDART00000132865 None None 207 None 5
ENSDART00000134504 None None 304 None 8

The following transcripts of ENSDARG00000015156 do not overlap with this mutation:

Genomic Location:
Chromosome 11 (position 28156027)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGCGTGACAAGATCACTGACTTGAGAATTTTTTATAGGTTTAGATGGT[G/T]AGCCAATAAGAGTCAACATTTTTTTTGCTGTTATATTGATACTATATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21929
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024992 None None 468 None 10
ENSDART00000103481 None None 328 None 2
ENSDART00000113707 Nonsense 679 1231 22 33
ENSDART00000131752 Nonsense 98 650 2 13
ENSDART00000132865 None None 207 None 5
ENSDART00000134504 None None 304 None 8

The following transcripts of ENSDARG00000015156 do not overlap with this mutation:

Genomic Location:
Chromosome 11 (position 28220377)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTACTACAGTTCCAGATAAACAACAAACTACCACTCAGATGCCGGTCT[T/G]ACATAACCCCTGTGCAGGTATGAACTGTTAAACATGCTGTAAATTTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16218
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024992 Essential Splice Site 3 468 2 10
ENSDART00000103481 None None 328 None 2
ENSDART00000113707 Essential Splice Site 766 1231 25 33
ENSDART00000131752 Essential Splice Site 185 650 5 13
ENSDART00000132865 None None 207 None 5
ENSDART00000134504 Essential Splice Site 24 304 2 8

The following transcripts of ENSDARG00000015156 do not overlap with this mutation:

Genomic Location:
Chromosome 11 (position 28237778)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATGTTTTATTTTAGAGTTTAGGAAGATAATGCTGTGCTTGTGTYTTGC[A/T]GATGTGAATGAKTGTGTGACGAACACACACACCTGTCGGGCAGRCGAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa812
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024992 Nonsense 139 468 4 10
ENSDART00000103481 None None 328 None 2
ENSDART00000113707 Nonsense 902 1231 27 33
ENSDART00000131752 Nonsense 321 650 7 13
ENSDART00000132865 Nonsense 120 207 3 5
ENSDART00000134504 Nonsense 160 304 4 8

The following transcripts of ENSDARG00000015156 do not overlap with this mutation:

Genomic Location:
Chromosome 11 (position 28241896)
KASP Assay ID:
554-0716.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAAGATCATCATGTGCAGTCGAGGTTACCATTCCAGTCCAGATGGAGCT[C/T]GATGTATTGGTGAGGACTATATAAATGTGCAAACATACAGCTCTGGACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1922
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024992 Nonsense 282 468 8 10
ENSDART00000103481 None None 328 None 2
ENSDART00000113707 Nonsense 1045 1231 31 33
ENSDART00000131752 Nonsense 464 650 11 13
ENSDART00000132865 None None 207 None 5
ENSDART00000134504 Nonsense 303 304 8 8

The following transcripts of ENSDARG00000015156 do not overlap with this mutation:

Genomic Location:
Chromosome 11 (position 28251369)
KASP Assay ID:
554-1911.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATATTGATGAGTGCTCACAGAGCATTGGAAACCTGTGTGCGTTTGAGTG[T/A]GTGAACGTGCCAGGGAGCTACACATGTGCCTGTCCTCCTCATGGTTATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8965
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024992 Nonsense 354 468 10 10
ENSDART00000103481 None None 328 None 2
ENSDART00000113707 Nonsense 1117 1231 33 33
ENSDART00000131752 Nonsense 536 650 13 13
ENSDART00000132865 None None 207 None 5
ENSDART00000134504 None None 304 None 8

The following transcripts of ENSDARG00000015156 do not overlap with this mutation:

Genomic Location:
Chromosome 11 (position 28259224)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGCATTGATCAAAACTCTAACATCTCCATTAATTTCAGACGCTGTGAA[C/T]GAATGAGTTGCCCCAACTACCAACAATGCCAGACCATGCCATTACGCATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zujwmx89