hspc049l

Ensembl ID:
ENSDARG00000015153
ZFIN ID:
ZDB-GENE-050113-2
Description:
WD repeat-containing protein 91 [Source:UniProtKB/Swiss-Prot;Acc:Q6TEN6]
Human Orthologue:
WDR91
Human Description:
WD repeat domain 91 [Source:HGNC Symbol;Acc:24997]
Mouse Orthologue:
Wdr91
Mouse Description:
WD repeat domain 91 Gene [Source:MGI Symbol;Acc:MGI:2141558]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43559 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43559
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013581 Missense 1 727 1 15
Genomic Location (Zv9):
Chromosome 21 (position 1910471)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 1561899
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTAATGCTGAGATTTTGCTCTGTCTGTCTGTCTGTCTTGTGTGTTGCA[G/A]TGTGTGTGATGGCGTCTGCGGTGGAGAGAACAGATGATCTGGTGAGAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link