gorasp2

Ensembl ID:
ENSDARG00000015126
ZFIN ID:
ZDB-GENE-040426-1659
Description:
Golgi reassembly-stacking protein 2 [Source:RefSeq peptide;Acc:NP_956997]
Human Orthologue:
GORASP2
Human Description:
golgi reassembly stacking protein 2, 55kDa [Source:HGNC Symbol;Acc:17500]
Mouse Orthologue:
Gorasp2
Mouse Description:
golgi reassembly stacking protein 2 Gene [Source:MGI Symbol;Acc:MGI:2135962]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20614 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20614
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013743 Essential Splice Site 21 434 1 10
Genomic Location (Zv9):
Chromosome 6 (position 3679101)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 3703405
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCGTGGAAATTCCCGGAGGCGGTTCTGAGGGTTATCACGTTCTCAGGG[T/C]GAGTGTGCTTTAGAGATGCTTCCGCTCTTTGCCTCTCTCTCTTTCACGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link