ddx39b

Ensembl ID:
ENSDARG00000015111
ZFIN ID:
ZDB-GENE-040426-2902
Description:
ATP-dependent RNA helicase DDX39 [Source:RefSeq peptide;Acc:NP_998142]
Human Orthologue:
DDX39
Human Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 [Source:HGNC Symbol;Acc:17821]
Mouse Orthologue:
Ddx39
Mouse Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 Gene [Source:MGI Symbol;Acc:MGI:1915528]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19934 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19934
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019957 Nonsense 412 427 9 10
Genomic Location (Zv9):
Chromosome 3 (position 6141451)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 5713894
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCCAAGATCCTGAACGACGTGCAGGACAGATTTGAGGTCAACGTGGCC[G/T]AGTTACCGGAGGAGATCGACATTTCCACTTACAGTGAGTCTGCAGTCTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link