dnajb11

Ensembl ID:
ENSDARG00000015088
ZFIN ID:
ZDB-GENE-031113-9
Description:
dnaJ homolog subfamily B member 11 [Source:RefSeq peptide;Acc:NP_942116]
Human Orthologue:
DNAJB11
Human Description:
DnaJ (Hsp40) homolog, subfamily B, member 11 [Source:HGNC Symbol;Acc:14889]
Mouse Orthologue:
Dnajb11
Mouse Description:
DnaJ (Hsp40) homolog, subfamily B, member 11 Gene [Source:MGI Symbol;Acc:MGI:1915088]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41458 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38747 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41458
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013282 Essential Splice Site 154 360 4 11
ENSDART00000123374 Essential Splice Site 154 360 4 10
Genomic Location (Zv9):
Chromosome 9 (position 33679149)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32835095
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACCTTGAAGTAACATTAGAAGAGGTGTATTCAGGGAATTTTGTGGAG[G/A]TGAGCTTCTTGTTTTTCTTGAACTTTCTCCATTTCCATTCTGATGTACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38747
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013282 Nonsense 157 360 5 11
ENSDART00000123374 Nonsense 157 360 5 10
Genomic Location (Zv9):
Chromosome 9 (position 33679000)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32834946
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTTTTTCCTGTCCTTCTGTTTCCTCTCTTTTTCAACATGTAGGTGGTA[C/T]GAATCAAACCGGTAGCAAAAGAAGCTCCAGGCAAAAGAAAATGCAACTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link