cx44.1

Ensembl ID:
ENSDARG00000015076
ZFIN IDs:
ZDB-GENE-010607-3, ZDB-GENE-010607-3
Description:
gap junction alpha-8 protein [Source:RefSeq peptide;Acc:NP_571884]
Human Orthologue:
GJA8
Human Description:
gap junction protein, alpha 8, 50kDa [Source:HGNC Symbol;Acc:4281]
Mouse Orthologue:
Gja8
Mouse Description:
gap junction protein, alpha 8 Gene [Source:MGI Symbol;Acc:MGI:99953]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9916 Essential Splice Site Available for shipment Available now
sa19567 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9916
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007262 Essential Splice Site None 391 None 2
ENSDART00000126904 Essential Splice Site None 391 None 2
Genomic Location (Zv9):
Chromosome 1 (position 47943640)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46755301
KASP Assay ID:
2259-1029.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTAAAAAGCWTATCTGCCTGCTTTCAAACATCYCTTTTGTTTGTTCCAC[A/T]GTGCTGACAGTCAACCATRGGTGACTGGAGTTTCTTGGGCAACATCCTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19567
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007262 Nonsense 343 391 2 2
ENSDART00000126904 Nonsense 343 391 2 2
Genomic Location (Zv9):
Chromosome 1 (position 47944684)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46756345
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAAACGCTGCCCTCTTACGCCCAGACGACCGTGATTGGACCGAGTGCAT[C/A]GTCAGGAATTCTGCGCAGGGATGAAGATGAGGACGAGTTGGCTGTGGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link