eng1b

Ensembl ID:
ENSDARG00000015073
ZFIN ID:
ZDB-GENE-980526-6
Description:
homeobox protein engrailed-1 [Source:RefSeq peptide;Acc:NP_001013516]
Human Orthologue:
EN1
Human Description:
engrailed homeobox 1 [Source:HGNC Symbol;Acc:3342]
Mouse Orthologue:
En1
Mouse Description:
engrailed 1 Gene [Source:MGI Symbol;Acc:MGI:95389]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu3426 Missense Available for shipment Available now
sa19415 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
hu3426
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016642 Missense 1 274 1 2
Genomic Location:
Chromosome 1 (position 6754205)
KASP Assay ID:
554-0089.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCATTGCAACAAGTGGAATTTTGGTGTGCAGACCACGATCCAGCTGTC[A/C]TGGACGAGCAAAAGGATCAAAATAGTCGTGATTCGACTGAGTCTGAGAGC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa19415
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016642 Nonsense 58 274 1 2
Genomic Location:
Chromosome 1 (position 6754034)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACGAACTTTTTCATCGACAATATTTTAAGGCCAGATTTCGGCTGCAAG[A/T]AAGATCCTGGGAGTAGGGATCGGGCGCAAACGTCGGGTAGGGAGAATGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/652a0vaz