dmrt2a

Ensembl ID:
ENSDARG00000015072
ZFIN ID:
ZDB-GENE-990621-7
Description:
doublesex- and mab-3-related transcription factor 2 [Source:RefSeq peptide;Acc:NP_571027]
Human Orthologue:
DMRT2
Human Description:
doublesex and mab-3 related transcription factor 2 [Source:HGNC Symbol;Acc:2935]
Mouse Orthologue:
Dmrt2
Mouse Description:
doublesex and mab-3 related transcription factor 2 Gene [Source:MGI Symbol;Acc:MGI:1330307]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33689 Essential Splice Site Mutation detected in F1 DNA During 2017
sa40541 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33689
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010786 Essential Splice Site 148 507 3 4
Genomic Location (Zv9):
Chromosome 5 (position 46627874)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44409139
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCGACACATCCGCCCATCGACCATGCTGGCAAAAAGCATTTTAGAAGG[T/G]GGGTAAAAACAACAACAACAACAACAAAAAAACAAATTCTGTAGCATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40541
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010786 Nonsense 457 507 4 4
Genomic Location (Zv9):
Chromosome 5 (position 46629227)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44410492
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAGGAGCTGCTGGAGGAAGCGGCGAAAAAGTTCAGGGAAGGTACAGCC[A/T]AAGACACAGTGGGACTCAAAAGCTCGGAAAGAGCGGCAAAGGACTTTGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link