pola2

Ensembl ID:
ENSDARG00000015070
ZFIN ID:
ZDB-GENE-030131-778
Description:
DNA polymerase alpha subunit B [Source:RefSeq peptide;Acc:NP_955875]
Human Orthologue:
POLA2
Human Description:
polymerase (DNA directed), alpha 2 (70kD subunit) [Source:HGNC Symbol;Acc:30073]
Mouse Orthologue:
Pola2
Mouse Description:
polymerase (DNA directed), alpha 2 Gene [Source:MGI Symbol;Acc:MGI:99690]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21243 Nonsense Available for shipment Available now
sa27160 Nonsense Mutation detected in F1 DNA During 2017
sa41166 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21243
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025803 Nonsense 68 600 3 19
Genomic Location (Zv9):
Chromosome 8 (position 17702211)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17147099
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACCAGAAAGCAGCTGCCGCTCACTCTCGAAAACCTGGACCAGTTTGAA[C/T]AAGAAGTTAGTAAAATGACATTAAAAACTCCAACTGAAATTCTGCAGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27160
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025803 Nonsense 319 600 10 19
Genomic Location (Zv9):
Chromosome 8 (position 17697494)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17142382
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGAAGGTATGAATCCCTCGGGGGAGAAGCTTGTTGCTACCAAGCTGTA[C/A]GAGGTAAGGTACCTCAGTCTGTTTGGTTTAGTTTACACTTTGTTAAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41166
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025803 Nonsense 572 600 19 19
Genomic Location (Zv9):
Chromosome 8 (position 17694389)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17139277
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATGTGTCAATCCTGGCCGTCTCACTAAAGGTCAGATAGGCGGGACTTA[C/A]GGACGGTTACTCATTCAGCCAAACCCTGCACTGGTGGAAGGCAAGAGAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link