TXK

Ensembl ID:
ENSDARG00000015068
Description:
TXK tyrosine kinase [Source:HGNC Symbol;Acc:12434]
Human Orthologue:
TXK
Human Description:
TXK tyrosine kinase [Source:HGNC Symbol;Acc:12434]
Mouse Orthologue:
Txk
Mouse Description:
TXK tyrosine kinase Gene [Source:MGI Symbol;Acc:MGI:102960]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4231 Nonsense Mutation detected in F1 DNA During 2016
sa9793 Essential Splice Site Available for shipment Available now
sa44058 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa4231
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102003 Nonsense 254 489 10 14
Genomic Location:
Chromosome 23 (position 44242147)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTGTGTGYAGATAAAATGGAGATCAACCCATCKGAGCTGACYTTCATG[A/T]AGGAGCTGGGTTCTGGTCAGTTTGGAGTGGTGCGACTGGGTAAATGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9793
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102003 Essential Splice Site 298 489 11 14
Genomic Location:
Chromosome 23 (position 44236572)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTGTGTGTGTGTGTGTGTGTGTGTTTTTGTGTKTKTGTGTGTGTNN[A/T]GGCGTCTCTGTCACCCTAAGCTGGTGCAGCTGTACGGTGTGTGTGTGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44058
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102003 Nonsense 421 489 13 14
Genomic Location:
Chromosome 23 (position 44231603)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCCAGGTTCCCTGTTAAATGGTCCCCGCCAGAAGTTCTGCACTTCAAC[A/T]AGTTCAGCAACAAGTCAGACGTGTGGTCATTCGGTGAGATCACCTGAAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link