TXK

Ensembl ID:
ENSDARG00000015068
Description:
TXK tyrosine kinase [Source:HGNC Symbol;Acc:12434]
Human Orthologue:
TXK
Human Description:
TXK tyrosine kinase [Source:HGNC Symbol;Acc:12434]
Mouse Orthologue:
Txk
Mouse Description:
TXK tyrosine kinase Gene [Source:MGI Symbol;Acc:MGI:102960]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4231 Nonsense Mutation detected in F1 DNA During 2014
sa9793 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa4231
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102003 Nonsense 254 489 10 14
Genomic Location:
Chromosome 23 (position 44242147)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTGTGTGYAGATAAAATGGAGATCAACCCATCKGAGCTGACYTTCATG[A/T]AGGAGCTGGGTTCTGGTCAGTTTGGAGTGGTGCGACTGGGTAAATGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9793
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102003 Essential Splice Site 298 489 11 14
Genomic Location:
Chromosome 23 (position 44236572)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTGTGTGTGTGTGTGTGTGTGTGTTTTTGTGTKTKTGTGTGTGTNN[A/T]GGCGTCTCTGTCACCCTAAGCTGGTGCAGCTGTACGGTGTGTGTGTGACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1qweppz7