daam1a

Ensembl ID:
ENSDARG00000015059
ZFIN ID:
ZDB-GENE-030911-6
Human Orthologue:
DAAM1
Human Description:
dishevelled associated activator of morphogenesis 1 [Source:HGNC Symbol;Acc:18142]
Mouse Orthologue:
Daam1
Mouse Description:
dishevelled associated activator of morphogenesis 1 Gene [Source:MGI Symbol;Acc:MGI:1914596]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18124 Essential Splice Site Available for shipment Available now
sa9001 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39153 Essential Splice Site Mutation detected in F1 DNA During 2017
sa6462 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18124
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024726 Essential Splice Site 148 1060 4 24
Genomic Location (Zv9):
Chromosome 17 (position 14383925)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 14501025
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAAACCATAGAGAGCCTGAAAACTGCTCTCCGCACACAGCCCATGAGG[T/C]ACTATCTTGAGCAATCACATTTACTGTTCCTCATTTCATACCTRTGGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9001
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024726 Essential Splice Site 296 1060 6 24
Genomic Location (Zv9):
Chromosome 17 (position 14379071)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 14496171
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCATCATGTCCTTCATCAACGCCGTCCTCAGTCAAGGAGCAGGGGAGG[T/C]AARCGCTACTTTCCNCCCCACACATCTGYCTCTCATTACATTCAAATCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39153
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024726 Essential Splice Site 458 1060 11 24
Genomic Location (Zv9):
Chromosome 17 (position 14371864)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 14488964
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGAACGAGGTGAAACAATGGAAAGAGCAAGCGGAAAAAATGAGGAAAG[G/A]TACAGTACATGACCTCTCTACGACCCCAATATTGATTAAAGCGACTGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6462
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024726 Nonsense 673 1060 15 24
Genomic Location (Zv9):
Chromosome 17 (position 14363313)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 14480413
KASP Assay ID:
554-5126.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGAYACTGTCACTTCTAAAAAGGTCAAAGAACTGTCTGTCATCGATGGA[C/T]GACGTGCRCAAAACTGCAACATCCTTCTCTCCAAGTGAGTCTGCAGCTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link