grip1

Ensembl ID:
ENSDARG00000015053
ZFIN ID:
ZDB-GENE-041210-125
Description:
glutamate receptor-interacting protein 1 [Source:RefSeq peptide;Acc:NP_001038316]
Human Orthologue:
GRIP1
Human Description:
glutamate receptor interacting protein 1 [Source:HGNC Symbol;Acc:18708]
Mouse Orthologue:
Grip1
Mouse Description:
glutamate receptor interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1921303]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40251 Nonsense Mutation detected in F1 DNA During 2016
sa17341 Essential Splice Site Available for shipment Available now
sa33422 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa40251
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026593 Nonsense 32 1143 1 24
Genomic Location (Zv9):
Chromosome 4 (position 12320129)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13256756
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACGCAAAGGCAAAAAGTACCGCCCTGAAGAGGATTACCATGAGGGTTA[C/A]GAGGACGTGTATTACTATGCTTCTGAGCACCTGCACCGTAAGTGCTACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17341
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026593 Essential Splice Site 45 1143 2 24
Genomic Location (Zv9):
Chromosome 4 (position 12221004)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13157631
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAGACAAGGTTTTGCTAATGTGTGGTTTTTAAATGCCTTGTGTTTTTC[A/G]GATGAGGGGCCCTACACTAAACACTCCAATCCCTCCAGGCCACCAGATGS
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33422
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026593 Essential Splice Site 421 1143 10 24
Genomic Location (Zv9):
Chromosome 4 (position 12175410)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13112037
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCGACCAGTCCCACAGCCAGGCCAAGAAAACCTCTCCAAGCAACCCCC[G/A]TAATGTTTCTTCCCTTTTTCCTTCATCCTCATGTGTCCCTCCTTGTCTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link