grip1

Ensembl ID:
ENSDARG00000015053
ZFIN ID:
ZDB-GENE-041210-125
Description:
glutamate receptor-interacting protein 1 [Source:RefSeq peptide;Acc:NP_001038316]
Human Orthologue:
GRIP1
Human Description:
glutamate receptor interacting protein 1 [Source:HGNC Symbol;Acc:18708]
Mouse Orthologue:
Grip1
Mouse Description:
glutamate receptor interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1921303]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17341 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17341
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026593 Essential Splice Site 45 1143 2 24
Genomic Location:
Chromosome 4 (position 12221004)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAGACAAGGTTTTGCTAATGTGTGGTTTTTAAATGCCTTGTGTTTTTC[A/G]GATGAGGGGCCCTACACTAAACACTCCAATCCCTCCAGGCCACCAGATGS
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7f2cuwju