nadl1.1

Ensembl ID:
ENSDARG00000015025
ZFIN ID:
ZDB-GENE-980526-512
Description:
Neural cell adhesion molecule L1.1 [Source:UniProtKB/Swiss-Prot;Acc:Q90478]
Human Orthologue:
L1CAM
Human Description:
L1 cell adhesion molecule [Source:HGNC Symbol;Acc:6470]
Mouse Orthologue:
L1cam
Mouse Description:
L1 cell adhesion molecule Gene [Source:MGI Symbol;Acc:MGI:96721]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12283 Nonsense Available for shipment Available now
sa756 Essential Splice Site Available for shipment Available now
sa39389 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37581 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa12283
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026177 Nonsense 664 1264 17 33
ENSDART00000055130 Nonsense 619 1224 14 26
ENSDART00000055131 Nonsense 664 1269 17 29
ENSDART00000132175 Nonsense 727 1332 17 29

The following transcripts of ENSDARG00000015025 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 623496)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 594487
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGTATGTGATTGAGATGAACGAGGGGGAGACTCCAGWCGAGGGTCAAT[G/A]GCAGAAATACAGGAGTGTTTCTCAGGACATCCGWCAGCTGGAGWTCCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa756
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026177 Essential Splice Site 681 1264 19 33
ENSDART00000055130   638 1224 14 26
ENSDART00000055131   683 1269 17 29
ENSDART00000132175   746 1332 17 29

The following transcripts of ENSDARG00000015025 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 623438)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 594429
KASP Assay ID:
554-0663.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAGGAGTGTTTCTCAGGACATCCGWCAGCTGGAGATCCACCTGCAGCC[C/A]TACAGCAAATACCACTTCCAGATCCGGGCAGTSAACAGCATAGGAACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39389
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026177 Essential Splice Site 1058 1264 29 33
ENSDART00000055130 Essential Splice Site 1018 1224 22 26
ENSDART00000055131 Essential Splice Site 1063 1269 25 29
ENSDART00000132175 Essential Splice Site 1126 1332 25 29

The following transcripts of ENSDARG00000015025 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 617518)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 588509
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAGACAGTTCTGCAGCTAATAATATTATATTAATACTAATGTTTTCGC[A/T]GAGGGTGCTGAATGGGAAGAGTCGGAGAAGATCAACTCCACACAGGCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37581
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026177 Essential Splice Site 1107 1264 29 33
ENSDART00000055130 Essential Splice Site 1067 1224 22 26
ENSDART00000055131 Essential Splice Site 1112 1269 25 29
ENSDART00000132175 Essential Splice Site 1175 1332 25 29

The following transcripts of ENSDARG00000015025 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 617366)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 588357
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCGGAAACACTTCTTATGACTGGGATTTCAAAACGATATACAGGCGAG[G/A]TACGCTCTCACGCTTATTTATTTACTGTTGTGCTTGTTGGTTATGAGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link