LOC561709

Ensembl ID:
ENSDARG00000015016
Human Orthologue:
KIF26A
Human Description:
kinesin family member 26A [Source:HGNC Symbol;Acc:20226]
Mouse Orthologue:
Kif26a
Mouse Description:
kinesin family member 26A Gene [Source:MGI Symbol;Acc:MGI:2447072]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8994 Nonsense Mutation detected in F1 DNA During 2016
sa23177 Nonsense Available for shipment Available now
sa36518 Nonsense Mutation detected in F1 DNA During 2016
sa36519 Nonsense Mutation detected in F1 DNA During 2016
sa23178 Nonsense Available for shipment Available now
sa1305 Nonsense Available for shipment Available now
sa36520 Essential Splice Site Available for shipment Available now
sa13169 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8994
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035152 Nonsense 139 2023 3 15
Genomic Location (Zv9):
Chromosome 17 (position 46054738)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 45903970
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGCASRAGGTGTCCGGCGTGTGKCTCATCAGCACAGCAGCTGAAACAR[C/T]AAGYGCTTCAGACTCTCCAAGATCTGTACCCCTGTCCYGAMATGCCATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23177
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035152 Nonsense 327 2023 5 15
Genomic Location (Zv9):
Chromosome 17 (position 46122575)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 45971807
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTTGTCATCTCAGGGCTGCTCAGAAGCTGAATCTATCATCCAAAAGG[A/T]AGAAGCAGCAGCCGCCACTGGTGTACCCCCAGGAGCCCTCCATCTACCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36518
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035152 Nonsense 418 2023 6 15
Genomic Location (Zv9):
Chromosome 17 (position 46130938)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 45980170
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACATGCGTAAGAAGCAGCTGACCCTCTACGACCCCTCACTCCACACA[C/T]AGCCCACCTCAGTGCACAGACGAGCAGTGCTGCCCGCCCCAAAGATGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36519
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035152 Nonsense 785 2023 12 15
Genomic Location (Zv9):
Chromosome 17 (position 46148128)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 45997360
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCAGATCTACCATCATTTCTCAGTGATCCTGACTATTCTTCAAGCAGC[G/T]AGCAGTCGTGTGACACTGTAATTTATGTTGGCCCTGGTGGTGCCGCCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23178
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035152 Nonsense 793 2023 12 15
Genomic Location (Zv9):
Chromosome 17 (position 46148154)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 45997386
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCCTGACTATTCTTCAAGCAGCGAGCAGTCGTGTGACACTGTAATTTA[T/A]GTTGGCCCTGGTGGTGCCGCCATCTCTGATCGAGAACTCAGCGACAACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1305
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035152 Nonsense 1460 2023 12 15
Genomic Location (Zv9):
Chromosome 17 (position 46150153)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 45999385
KASP Assay ID:
554-1220.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAGTTTGAAATTCTCCTCTTTAGGAAAAAGTGGAAAAGCTAATAAGCAG[G/T]AAGAGASTATGTCAAAACCTGGCAACGTCTCACCACCTCTTCCTCCAGTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa36520
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035152 Essential Splice Site 1850 2023 12 15
Genomic Location (Zv9):
Chromosome 17 (position 46151327)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 46000559
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCTCTGGTCGCACAAGAAGCTCCAAAGTACCCAAGAAGAGGTCAAATG[G/A]TAAGTATTATGCTTTTTTTTATGAATAATCTGTTGATTCTATGATTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13169
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035152 Nonsense 1929 2023 14 15
Genomic Location (Zv9):
Chromosome 17 (position 46154613)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 46003845
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCACAGGGCCTGATGTATTTTAGCACRAAAATGAAGGTTCTTRAGAAA[C/T]GACAACAGCAAATCAGAGATCTYAGAGCCAARCATAAGACTCTGAWAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link