LOC561709

Ensembl ID:
ENSDARG00000015016
Human Orthologue:
KIF26A
Human Description:
kinesin family member 26A [Source:HGNC Symbol;Acc:20226]
Mouse Orthologue:
Kif26a
Mouse Description:
kinesin family member 26A Gene [Source:MGI Symbol;Acc:MGI:2447072]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8994 Nonsense Mutation detected in F1 DNA During 2014
sa23177 Nonsense Mutation detected in F1 DNA During 2014
sa23178 Nonsense Mutation detected in F1 DNA During 2014
sa1305 Nonsense Available for shipment Available now
sa13169 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8994
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035152 Nonsense 139 2023 3 15
Genomic Location:
Chromosome 17 (position 46054738)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGCASRAGGTGTCCGGCGTGTGKCTCATCAGCACAGCAGCTGAAACAR[C/T]AAGYGCTTCAGACTCTCCAAGATCTGTACCCCTGTCCYGAMATGCCATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23177
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035152 Nonsense 327 2023 5 15
Genomic Location:
Chromosome 17 (position 46122575)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTTGTCATCTCAGGGCTGCTCAGAAGCTGAATCTATCATCCAAAAGG[A/T]AGAAGCAGCAGCCGCCACTGGTGTACCCCCAGGAGCCCTCCATCTACCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23178
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035152 Nonsense 793 2023 12 15
Genomic Location:
Chromosome 17 (position 46148154)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCCTGACTATTCTTCAAGCAGCGAGCAGTCGTGTGACACTGTAATTTA[T/A]GTTGGCCCTGGTGGTGCCGCCATCTCTGATCGAGAACTCAGCGACAACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1305
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035152 Nonsense 1460 2023 12 15
Genomic Location:
Chromosome 17 (position 46150153)
KASP Assay ID:
554-1220.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAGTTTGAAATTCTCCTCTTTAGGAAAAAGTGGAAAAGCTAATAAGCAG[G/T]AAGAGASTATGTCAAAACCTGGCAACGTCTCACCACCTCTTCCTCCAGTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa13169
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035152 Nonsense 1929 2023 14 15
Genomic Location:
Chromosome 17 (position 46154613)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCACAGGGCCTGATGTATTTTAGCACRAAAATGAAGGTTCTTRAGAAA[C/T]GACAACAGCAAATCAGAGATCTYAGAGCCAARCATAAGACTCTGAWAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/oflittc1