tspan18b

Ensembl ID:
ENSDARG00000015015
ZFIN ID:
ZDB-GENE-040718-137
Description:
tetraspanin 18b [Source:RefSeq peptide;Acc:NP_001002439]
Human Orthologue:
TSPAN18
Human Description:
tetraspanin 18 [Source:HGNC Symbol;Acc:20660]
Mouse Orthologue:
Tspan18
Mouse Description:
tetraspanin 18 Gene [Source:MGI Symbol;Acc:MGI:1917186]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4754 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4754
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020137 Essential Splice Site 203 246 7 9
ENSDART00000141835 Essential Splice Site 215 258 7 9
Genomic Location:
Chromosome 18 (position 27758772)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAACCGGGAGGAATGCCTGTCGGGCAGCATGCTGTACCGGAWCAACAAG[G/A]TAGAGTACGTCACATCCCCTCAGCCTGCTCCAAAGCTAGCTCAGATTCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Schizophrenia: Genome-wide association study identifies a susceptibility locus for schizophrenia in Han Chinese at 11p11.2. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yo8y6e8r